upload
Food and Agriculture Organization of the United Nations
Industry: Agriculture
Number of terms: 87409
Number of blossaries: 0
Company Profile:
Established in October 1945 with the objective of eliminating hunger and improving nutrition and standards of living by increasing agricultural productivity, FAO coordinates the efforts of governments and technical agencies in programs for developing agriculture, forestry, fisheries, and land and ...
Condizione in un gruppo di organismi incroci in cui le frequenze alleliche rimangono costanti nel tempo.
Industry:Biotechnology
Pasmo dwupoziomowy DNA, który zawiera taką samą sekwencję podstawy (po podstawiając U T) Znalezione w cząsteczce mRNA w wyniku transkrypcji tego odcinka DNA. vel sensie nici. Cząsteczki mRNA jest przepisywana od innych strand, znany jako szablon lub antysensowe nici.MRNA kodowanie nici 5´ ATGAAAGCTTTAGTGGGCGCCCGTAT 3´ szablon nici 3´ TACTTTCGAAATCACCCGCGGGCATA 5´ 5´ AUGAAAGCUUUAGUGGGCGCCCGUAU 3´
Industry:Biotechnology
Drobnoustrojów, które mogą rosnąć w temperaturze poniżej 30° C i tak niskie, jak 0° C.
Industry:Biotechnology
Mikro organizmów, która rośnie w obecności tlenu. Przeciwnej: anaerobe.
Industry:Biotechnology
Vidurinis gemalo sluoksnis, kuri pradžioje gyvūnų embrionų ir suteikia didėjimas dalims, pavyzdžiui, kaulų ir jungiamojo audinio.
Industry:Biotechnology
Pieno gamybos organų moterų žinduolių, kurie minta jaunas.
Industry:Biotechnology
Kiek mažiausiai organizmų arba ląstelių veiksmingą atrankos procese.
Industry:Biotechnology
Kraujo ir kitų skysčių, bestuburis kūno ertmėje mišinys.
Industry:Biotechnology
Proteine coniugate è composto da acidi nucleici e proteine; il materiale di cui sono fatti i cromosomi.
Industry:Biotechnology
Mikro organizmów którego naturalnym środowiskiem są w pobliżu, na lub w korzenie roślin.
Industry:Biotechnology
© 2026 CSOFT International, Ltd.