upload
Food and Agriculture Organization of the United Nations
Industry: Agriculture
Number of terms: 87409
Number of blossaries: 0
Company Profile:
Established in October 1945 with the objective of eliminating hunger and improving nutrition and standards of living by increasing agricultural productivity, FAO coordinates the efforts of governments and technical agencies in programs for developing agriculture, forestry, fisheries, and land and ...
Une seconde mutation sur le même site un gène de la mutation initiale. La seconde mutation rétablit la séquence nucléotidique de type sauvage.
Industry:Biotechnology
A la section à une extrémité des chromosomes X et Y pour lesquels il n'y a homologie suffisante qu'il est l'appariement (Synapse) au cours de la méiose I.
Industry:Biotechnology
Стъпките в производство на вирусни които обикновено водят до разпад на клетки.
Industry:Biotechnology
Нишка от ДНК, която се синтезира непрекъснато по време на репликация.
Industry:Biotechnology
Нишка от ДНК, която се синтезира прекъсвания по време на репликация (защото синтез на ДНК може да продължи само в 5´ да се 3´ посока).
Industry:Biotechnology
Направление на дуплекс ДНК, която съдържа същата последователност на база (след заместване U на Т) намерени в молекулата на иРНК, произтичащи от транскрипция на този сегмент от ДНК. известен още като смисъл направление. ИРНК молекула се преписват от други strand, известен като шаблон или антисенс направление. Кодиране направление 5´ ATGAAAGCTTTAGTGGGCGCCCGTAT 3´ шаблон направление 3´ TACTTTCGAAATCACCCGCGGGCATA 5´ иРНК 5´ AUGAAAGCUUUAGUGGGCGCCCGUAU 3´
Industry:Biotechnology
Направление на двойната спирала на ДНК, които всъщност се преписват. Също така известен като антисенс или шаблон направление.
Industry:Biotechnology
Un segment d'un gène d'eucaryote est transcrit dans le cadre de la transcription primaire et est conservé, après traitement, avec autres exons pour former une molécule d'ARNm fonctionnelle.
Industry:Biotechnology
Un segment d'une protéine ayant une fonction discrète ou conformation. Au niveau de la protéine, un domaine peut être aussi petit que quelques résidus d'acides aminés ou plus grand que la moitié de l'ensemble des protéines.
Industry:Biotechnology
Un segment d'acides aminés environ 15 à 30 à l'extrémité N terminale d'une protéine, ce qui permet à la protéine d'être sécrétée (passage à travers une membrane cellulaire). Le signal séquence est supprimée car la protéine est secrétée. Aussi appelée peptide signal, peptide de tête.
Industry:Biotechnology
© 2026 CSOFT International, Ltd.