upload
Food and Agriculture Organization of the United Nations
Industry: Agriculture
Number of terms: 87409
Number of blossaries: 0
Company Profile:
Established in October 1945 with the objective of eliminating hunger and improving nutrition and standards of living by increasing agricultural productivity, FAO coordinates the efforts of governments and technical agencies in programs for developing agriculture, forestry, fisheries, and land and ...
Simptomi, kas rodas kopā un pārstāvēt konkrētu slimību grupu.
Industry:Biotechnology
Perioada animale poartă vii tinere (în special mamifere) de fertilizarea ou la naştere a tinerilor (fătare).
Industry:Biotechnology
Enzymen die het katalyseren van de interconversion van de twee suikers, glucose en fructose. Zoals fructose chemisch stabieler dan glucose is, een mengsel van glucose en fructose met het enzym zullen eindigen met het bijna volledig als fructose. Dit is waardevol voor de voedingsmiddelenindustrie, zoals fructose is aanzienlijk zoeter dan glucose, en dus meer zoetheid per gram wordt bereikt met behulp van fructose. De gebruikelijke gebruik voor glucose isomerase is te nemen glucose gemaakt door hydrolyse van maïszetmeel en zet het in een mengsel van meestal fructose met sommige glucose. De maïs zetmeel wordt afgebroken met behulp van amylasen. Het resultaat heet high-fructose corn siroop (HFK's). Invertase neemt sacharose en verandert het in glucose en fructose.
Industry:Biotechnology
டிஎன்ஏ பிரதியெடுப்பு ஆண்டில் தொடர்ந்து synthesized உள்ளது, இந்த strand.
Industry:Biotechnology
இது synthesized ஆண்டில் பிரதியெடுப்பு discontinuously (ஏனெனில் டிஎன்ஏ சித்தர்களில் முடியும் தொடர, 5´ உள்ள மட்டும் செய்ய 3´ திசை) டிஎன்ஏ, அந்த strand.
Industry:Biotechnology
Kādā mehāniski darbina lāpstiņrati jaukto šūnu vai mikroorganismu augšanas kuģa.
Industry:Biotechnology
Haploīdu (n) sporas attīstās par sieviešu Gametofīts heterosporous iekārtās.
Industry:Biotechnology
Faza a ciclului celular, în ADN-ul care are loc sinteza.
Industry:Biotechnology
Enzymen die het katalyseren van de interconversion van de twee suikers, glucose en fructose. Zoals fructose chemisch stabieler dan glucose is, een mengsel van glucose en fructose met het enzym zullen eindigen met het bijna volledig als fructose. Dit is waardevol voor de voedingsmiddelenindustrie, zoals fructose is aanzienlijk zoeter dan glucose, en dus meer zoetheid per gram wordt bereikt met behulp van fructose. De gebruikelijke gebruik voor glucose isomerase is te nemen glucose gemaakt door hydrolyse van maïszetmeel en zet het in een mengsel van meestal fructose met sommige glucose. De maïs zetmeel wordt afgebroken met behulp van amylasen. Het resultaat heet high-fructose corn siroop (HFK's). Invertase neemt sacharose en verandert het in glucose en fructose.
Industry:Biotechnology
இருவழி strand உள்ள அலுவலகத்திடம் இருந்து அந்த துண்டு டிஎன்ஏ transcription mRNA molecule அதே அடிப்படை வரிசை முறை (பிறகு-T U மீன்கள் நன்னீர் மீன்வளர்ப்புக்கு) கொண்ட டிஎன்ஏ காணப்படவில்லை. பார்த்தால் a.k.a. strand. , MRNA molecule இருந்து, மற்ற strand, வார்ப்புரு அல்லது antisense strand அழைக்கப்பட்ட transcribed உள்ளது. Coding strand 5´ ATGAAAGCTTTAGTGGGCGCCCGTAT 3´ வார்ப்புரு strand 3´ TACTTTCGAAATCACCCGCGGGCATA 5´ mRNA 5´ AUGAAAGCUUUAGUGGGCGCCCGUAU 3´
Industry:Biotechnology
© 2026 CSOFT International, Ltd.